EST 1689124 is a singleton


Sequence

>1689124 (1 EST) Length=174 GCGGAAAAACTTCAGCTCACAAGAGCTTAACTGGCAATCTCTCTCTCCGACCTAGCCGGTTAACTGTTCCATTCAAAAAC CGCAAAGTTTGAGAAGTTTTATCAAGCAGCACCGACTTTTGATCAGAGATCGGACAACTAATTACTTGAATGGAACCTTC CTTGATGTTTTCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1689124: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891243116493AA952787SMTBCEA000110SKSchistosoma Lambda Zap II cercariae


Date: 20:43:35 on Thu 23 Nov 117.