EST 1689125 is a singleton


Sequence

>1689125 (1 EST) Length=183 GCCAACCAAAACAGATTCAATCTTCCAAGACCAGGTTTCCCGGCCAAGTGAAGGTGTTTACAATAATCCGCATGGGTCCC CTCGGATATGGACATAAATCCAAACTAATTAACCTTGTTCCTTTGCTTACCTGGAACATTTCAGGAGGAAATTCCGGGAT GTCAGCAAACAACTTTAATAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1689125: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891253116494AA952788SMTBCEA000112SKSchistosoma Lambda Zap II cercariae


Date: 5:54:45 on Sun 19 Nov 117.