EST 1689128 is a singleton


Sequence

>1689128 (1 EST) Length=153 CTAAAAGCGTTCAAGGTCAGAGTGGATGTCGCTGAGCTCATGGCCGGTGGCTTCGGTTAGTCTCGGTGGCCTCGGGTAGT AAGGTTGTATACAGAGGAGTTTTAGCTTTGGAGTTAAGTAGCTTTGAAAGCAAGTAGTTCCTGGTGGCACCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689128: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891283116497AA952791SMTBCEA000142SKSchistosoma Lambda Zap II cercariae


Date: 6:22:24 on Fri 24 Nov 117.