EST 1689129 is a singleton


Sequence

>1689129 (1 EST) Length=111 CTGACTAAAGTTAGTTATTGCCTGTGATCTGATATGCTGTTAGCTAGCTACTTATTGATGCAGTTAGAGAATAGCTGATC TCTTGCTATTGCTTAGAGAGACAGATATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1689129: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891293116498AA952792SMTBCEA000148SKSchistosoma Lambda Zap II cercariae


Date: 16:11:36 on Sat 18 Nov 117.