EST 1689130 is a singleton


Sequence

>1689130 (1 EST) Length=180 GGGGCAAATGTAGCATTATTCATTTCAGTCATTTCAGATTCCTTCACAGGATAAGAAAGGATAAACGCTTACCTTGAGGA ATAACCTGAGTAAAGGCACAGGAAGCAGGCTTCTATGAGGCTATTAGACTCCTGAGCCGTACTTGTTCAAACCTGTACGT AGAGCGTGAAGAGCCGACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689130: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891303116499AA952793SMTBCEA000150SKSchistosoma Lambda Zap II cercariae


Date: 20:51:56 on Thu 23 Nov 117.