EST 1689131 is a singleton


Sequence

>1689131 (1 EST) Length=117 TTCAAAGAATCTATAATGATGAATCAATTAGATCGGCTTATTCGATATTTACATTCCAAGAATTAGGATTGTTAAGATTA TTTCCTCTTGTGAATCCCTTCGCTCATTAGCCCTTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1689131: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891313116500AA952794SMTBCEA000152SKSchistosoma Lambda Zap II cercariae


Date: 18:57:25 on Sun 19 Nov 117.