EST 1689142 is a singleton


Sequence

>1689142 (1 EST) Length=193 CTACGTCGATTTTTCTTCGGTACAAGCAAACGACACAGCTACTACACTCTGATGACCCTACACGACAACCGACACACAAC TTGATCATTCGCTAACTGGATAGAAAAACCTAAAACAATGCGTTCTGGAAGATTGAGTAAGATTTCCAGAACACTTAACG AATATTGAGATGGTCATAAGCTTACTTGATTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1689142: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891423116511AA952805SMTBCEA000175SKSchistosoma Lambda Zap II cercariae


Date: 13:31:19 on Wed 22 Nov 117.