EST 1689144 is a singleton


Sequence

>1689144 (1 EST) Length=134 TCAAGTGTAGGTCGTTTACAATAAGCGCATAGGACCTCTGATATGAGCACAGTAGAATCCAAACTATTACGGTGGGGTGC CTGGAACATTCAGGAAATCATACAGGCATTCGCGCAACATATATCACAACCAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1689144: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891443116513AA952807SMTBCEA000177SKSchistosoma Lambda Zap II cercariae


Date: 0:43:16 on Thu 23 Nov 117.