EST 1689146 is a singleton


Sequence

>1689146 (1 EST) Length=135 GGGGGGGCCCGTACCCAATTACCCTATAGTGAGTCGTTATTACAATTCACTGGCCCGTCCGTTTTACAACCGATTCCGAT TGACCGTGGAAAATCATCTGCGATCGCGTTACCCCAACCTTAAGATCGATCGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1689146: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891463116515AA952809SMTBCEA000180SKSchistosoma Lambda Zap II cercariae


Date: 2:50:3 on Fri 19 Jan 118.