EST 1689147 is a singleton


Sequence

>1689147 (1 EST) Length=273 GAACAGAAACGAAAGGATCGATCTAGGACGGTCGATAGAACCTTATATCCCAAGCAGGGAGCTATACCGGTTTGTGATGT CTCTCGAGAATCCTCAGAGATATTCCAAAGTCTTCAAGAACATGGTCGGTTAGAAACAGACATCGATGTTCTTACGGAGC TCAGGCAGAGAATCAACAACTCAAACACGCCATGTGCTTCTTGGGTAAAGACTCCGTATCCCTTCAGAACCAGCTCTAAG GTAAGATCGGTTCAGGAGATATACGGGAACTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689147: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891473116516AA952810SMTBCEA000182SKSchistosoma Lambda Zap II cercariae


Date: 22:12:26 on Fri 17 Nov 117.