EST 1689149 is a singleton


Sequence

>1689149 (1 EST) Length=88 TGGTAGTCTTCACATCAAAAACGTACACGATTTTCACACACGATCACGACATGCACACATGGGCCCAAACATCAGGAGCA TTCGATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689149: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891493116518AA952812SMTBCEA0000187SKSchistosoma Lambda Zap II cercariae


Date: 23:34:53 on Sat 18 Nov 117.