EST 1689152 is a singleton


Sequence

>1689152 (1 EST) Length=176 TTTGGATTGCCAAGGAAAACAGAGGCAATCTTCAAGTACCAGGTTTCTAGTAGGCCAAGACGAAGGTCGTTTACAATAAT CGCATGGTACCCTCCGAATATCGGCAATATGAATCCAATAGTAAGGAATGGTTTGGATTAGTCCTTCCGGTAACCATTTA AGGAAGGAAATTAGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1689152: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891523116521AA952815SMTBCEA000199SKSchistosoma Lambda Zap II cercariae


Date: 1:36:53 on Sat 18 Nov 117.