EST 1689154 is a singleton


Sequence

>1689154 (1 EST) Length=83 TTTAATTGGAACCCTAGGCCAAAAGTGTCAGTTTGTTTAGAATCGAAGATCCAACTGTATGAATTAAATCAGTGAAGATT AAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689154: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891543116523AA952817SMTBCEA000201SKSchistosoma Lambda Zap II cercariae


Date: 2:14:10 on Wed 22 Nov 117.