EST 1689157 is a singleton


Sequence

>1689157 (1 EST) Length=185 ATGATAGCCTTTCTCATACTTCAAACGTGTGTCACTATTTATACCAATATATTGAACGACAGTAGTTTGAATCCATGTAG TTACGCACGTCACATAATAATTTCTATGGTTGGAACCAAGATTGGCTTTTTTTGACTACTCTAAATCACGTTCATATAGA AGTTGCATCTAAAAACATATAGTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689157: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891573116526AA952820SMTBCEA000259SKSchistosoma Lambda Zap II cercariae


Date: 16:18:16 on Sun 19 Nov 117.