EST 1689158 is a singleton


Sequence

>1689158 (1 EST) Length=178 AAATTGACGATTTTATTCTTTTANACGTTTTAGTTTTTTTCGTGGTAGGTAAGTAGGAGGTATACCTCTATACTATTTTT TTCAGNGAATTTCTGACTTTCTTGCGCCACCCAGTCACATCGATAACGATTTATATAGTCTGATTAAGTTTCAACANCAG CACGCTTCAGTAGAAGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689158: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891583116527AA952821SMTBCEA000261SKSchistosoma Lambda Zap II cercariae


Date: 2:40:45 on Thu 23 Nov 117.