EST 1689159 is a singleton


Sequence

>1689159 (1 EST) Length=234 GTTCTNCNNTGGGCAAACGTAGCTTTANAAGATGCTTGACAACTAAACAACGTCTAGTNCAGTTCAATCTTTTATACTGG TCGTCACATTTATTGCCAGATTTAGANNGCGTAGTTTCGTAAATAGGCAAGACTCAAGGNNCATTGCTACGCATGTCTTC TACTGTCAAAGACATNTCTGCGCTAGTAACACACTCTCTGCATCTCACTGACTGCTTCGCTACTCTAAAGACCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689159: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891593116528AA952822SMTBCEA000291SKSchistosoma Lambda Zap II cercariae


Date: 6:10:12 on Sun 19 Nov 117.