EST 1689160 is a singleton


Sequence

>1689160 (1 EST) Length=111 GTTAGCCAACGCAAAGTGATATTTGTATTAGGTGGACCAGGAGTGGTAAGGGACACAGTGTGAAAATTAGTCAGAAATTT CATTTACACTTGCAGTGAGTCTACAGCTGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689160: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891603116529AA952823SMTBCEA000400SKSchistosoma Lambda Zap II cercariae


Date: 6:5:27 on Sun 19 Nov 117.