EST 1689162 is a singleton


Sequence

>1689162 (1 EST) Length=120 TTCAGAGTTTGTCAAGAACAAAGTTGATATTGGTAATAAGGTGGACCAGGAGGTGTAAGGAAACCGTGTGAAAATTGAAT ACAGAAATTTTATTTTATCACTTATTCCGTGGTGATCGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689162: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891623116531AA952825SMTBCEA000402SKSchistosoma Lambda Zap II cercariae


Date: 9:17:52 on Sat 18 Nov 117.