EST 1689164 is a singleton


Sequence

>1689164 (1 EST) Length=139 AGAGAGAGAGAACTAGTTTTTTTCAAAGGTTCTGGAATTTTATTACCAAGTTTGACCTAGCTAACGAAATTTAACTACTA AACCTCGTAAATCCAGTAATCCTCAGAGAGGGATTCAAATTTATAGAAACATATAAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1689164: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891643116533AA952827SMTBCEA000405SKSchistosoma Lambda Zap II cercariae


Date: 12:15:41 on Mon 20 Nov 117.