EST 1689165 is a singleton


Sequence

>1689165 (1 EST) Length=158 AGAGTTATGGGAAGTTGGGTTTACTCTCCTAAGAGAGGATTTAGATGTTAGACTATTTACAAGACACTGCTATACATTAG GGCACAGTTGGAATTTTCGGCAGTTCAAATTTTCCTTTAAAATGAGCAGCACATGAAGAAGAAATAAAGAAAATTAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 1689165: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891653116534AA952828SMTBCEA000407SKSchistosoma Lambda Zap II cercariae


Date: 14:36:27 on Fri 17 Nov 117.