EST 1689166 is a singleton


Sequence

>1689166 (1 EST) Length=243 GATATTACAATTCTTTAGAGGAGTCCGGAGTCCGGTTGCTTATTACTGATAGAATATGAAGCAGTTATGTTATCCAGTGA TATACTCTGATTTGAATTGCGCGCGAAACGGTCGATGAATGGAATAGATCATTCATAAGAGTCAGTTGAATCTAACTAAG ACACTTCGCGTGACGTTATACTTTATTTACTAAATATTCAAAAGCCAATTTTCATTACTAAATCGTGTTCATATCGTATA CGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1689166: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891663116535AA952829SMTBCEA000409SKSchistosoma Lambda Zap II cercariae


Date: 6:17:44 on Fri 24 Nov 117.