EST 1689167 is a singleton


Sequence

>1689167 (1 EST) Length=213 TCTCAAATCAAGGCCAAGTAGATTCCTAACAGAGTTTCCAGATGTTGTTGGAAGCATCGCCATTGCCAATACCCGATAGT TGACAACATAAGTTCTGCTTCCGATGAGTTACAGTCGCTCAGTTTAGTTGGATCATCGAAAGCCATGATATCTATCAGAA AAGCCCTTTCTTTTGCTGAGAGATAGTCTCAACAGGATCACATATTACATCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1689167: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891673116536AA952830SMTBCEA000410SKSchistosoma Lambda Zap II cercariae


Date: 14:51:43 on Sun 19 Nov 117.