EST 1689170 is a singleton


Sequence

>1689170 (1 EST) Length=168 TTCCAACTTACTAGCTGAACGTATATCATACCTAGGATAAGGTTGATTAAGGTGTGTTCCACTTGCAGGACACAGACATG GACACATGGTTGATGACTGCTTAGCCTGCAGAATTGAGACTGATGCCTGCCTAGTGGCTGTGTTTGAGACTGAACACACA CCCTCTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1689170: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891703116539AA952833SMTBCEA000416SKSchistosoma Lambda Zap II cercariae


Date: 14:41:25 on Fri 17 Nov 117.