EST 1689173 is a singleton


Sequence

>1689173 (1 EST) Length=127 CTACCTTTTTGTAGTATCTTCTTTTGTGTTGCTTACTTCAGGAAATGTAGGGAGTTCCTGGGGCTACCGAAAACTGCAGC GTAACAACGCGAACCAATGAAAATTCGGTCATGAGTTGGCCAAGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689173: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891733116542AA952836SMTBCEA000501SKSchistosoma Lambda Zap II cercariae


Date: 4:59:53 on Tue 21 Nov 117.