EST 1689174 is a singleton


Sequence

>1689174 (1 EST) Length=213 ACTGGCGAACATGCTGGGACTTACTATCCATTAACTGATATGAAAGAAGAAGAAGACAGAAAACAACTAGTCGAAGACGA TTTCCTATTTAAAAATGATGATCTTGTTCTAGCGTGGTGGCCGGTATATGCGTAGGCCTGTTGGAGCGGTAATTTTCCAC AACAATTCAAAGACTTTCCTTGTGTGGGTTTGTGAAGAAGAAGATCCAAGGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 1689174: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891743116543AA952837SMTBCEA000503SKSchistosoma Lambda Zap II cercariae


Date: 16:32:26 on Fri 17 Nov 117.