EST 1689176 is a singleton


Sequence

>1689176 (1 EST) Length=152 TTCCCATCTCTATTACGTTTTATACATCGTTAGCTTTGATAGGTGTTTTTGTATTCGGAAAATTCAATTTAGGAAGACCA ACAACGAATTGTATTCGGAAATGTGTTAAACTCCAGAATGGACTTAATGGCTATCATATTTTTAGTAAGGCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689176: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891763116545AA952839SMTBCEA000505SKSchistosoma Lambda Zap II cercariae


Date: 4:31:10 on Thu 23 Nov 117.