EST 1689177 is a singleton


Sequence

>1689177 (1 EST) Length=283 ACCGAGAGCCTGAACCGCAGAAGCAACTTGGAGAGCTTAAGACTTAACTTGGTAAGTGCTTCGCTTGTATCTAGTAACGA GAGGCGCATCCTACCATGGGAAGTTGAAGAAAATGCCTTTACACTAAGAAAGTCCATTGCTCGTGTATATACAGTTATTC ATCAGGCTCAAAAACTTCGCCAGCGTGAAGCTTATCGTTCCAAAAGATATGTTCCCAAAGATTTGAGACCGAAGAAGAAC AGAGCAATACGCAGAGGCATACCAAAAAGAAGCTACTTCCTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1689177: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891773116546AA952840SMTBCEA000506SKSchistosoma Lambda Zap II cercariae


Date: 2:25:8 on Wed 22 Nov 117.