EST 1689180 is a singleton


Sequence

>1689180 (1 EST) Length=237 TTGACACTAATGAGGGCATGCGTGGTAATCGGTGCTGAACGGGTTCGGTCAAGCATATGAGAGCTACTGCTAATGATACT GGGGCGGCAAGCTATATAATTGGGAAAACTTTCAAACTGGGGGATGATCCCCTGCAAGCCTAGAAGACTGGCAATTATGG TGGCGGCAGGAGAGGGCGTGAGCAGCAGCTGAACCATAACCTGATCATGAACTACGGTGCGGCTGATTGGTCGCAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689180: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891803116549AA952843SMTBCEA000513SKSchistosoma Lambda Zap II cercariae


Date: 15:5:25 on Wed 22 Nov 117.