EST 1689181 is a singleton


Sequence

>1689181 (1 EST) Length=238 TAATCCGACTTCTTCCCGTTGAAGATTATTTCGCCCTAAATTAGGTTCGCCGAGCGGGCCGACGTTTTAGCCGATTACGA AGCCCGTGATAGGTATAGCAGCAATTATGTTCGTTTCCGTGATGTGCCTTGCTCATCGAGAGTGGCTCGTGGCCTTTGAA CTTTCGGTGAATCCGTATTCTGCCGAGGCAGCCGTTTCTTCTTAAGCAGAACTGCTTGGAGGAATAAGGTATAAAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689181: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891813116550AA952844SMTBCEA000514SKSchistosoma Lambda Zap II cercariae


Date: 13:46:56 on Thu 23 Nov 117.