EST 1689183 is a singleton


Sequence

>1689183 (1 EST) Length=240 CCGTTGGTAATAATGTCTAAGCTGATTGAACTGAAATAGGATGGTGACATGGAAAGTTTGCTAGAGCAACATAAGAATAA GTTGGTTGTGGTTGATTTTTTTGCCACATGGTGTGGCCCGTGTAAAACCATAGCTCCTCTGTTCAAAGAATTAAGCGAGT TGTATATATCAATTTTCGTGAAAGTTGATGTGCACAACTTGCCGAGACGCCAGAAGTACATTTCCGCTACCGACGCTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1689183: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891833116552AA952846SMTBCEA000516SKSchistosoma Lambda Zap II cercariae


Date: 14:38:18 on Tue 21 Nov 117.