EST 1689190 is a singleton


Sequence

>1689190 (1 EST) Length=174 GGGCATTTGTACATCAGGTCCTACTGGCTTGACTGGTTTAAGCAAAGGCTTATTCTTCCAGAAAGAAGCGCAAGTGGCTT CAAACCAGTCTTAACTTCATTTCCCGTTTCACACGGTTGGTTCGGTTACTTAAAGAAAAAGCCATACAACAAAGGTAGGC ACGGTTAAGTGTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689190: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891903116559AA952853SMTBCEA000525SKSchistosoma Lambda Zap II cercariae


Date: 4:37:41 on Thu 23 Nov 117.