EST 1689191 is a singleton


Sequence

>1689191 (1 EST) Length=91 TCGCTCATCTGTCTTTCCGATTACATACATAAATCTCTGTAGCTAAGGAAGAAGCAGAAAAAACTAACTCACAGTTCAGT CAGTATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1689191: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16891913116560AA952854SMTBCEA000526SKSchistosoma Lambda Zap II cercariae


Date: 8:42:20 on Fri 24 Nov 117.