EST 1694415 is a singleton


Sequence

>1694415 (1 EST) Length=269 TANTCGGCATGAGGGACGGTCAGATCACGGAANATCGTTTGGAGCTGCGCAGGCTGCTTTTGCGAGCGGAGGAAAATCGT CAAATTGTTGTGTTTGTGCTTCTNGATGTCAAGTCTGCTGCTGCTCCCACCGCTGCTGTCGGCGGTGGTGGTGTGGCTTC TGTCGGGGANAGTTGTGTGGCGCAGAAAGANACTGGAAGCCTATCTACCGCCCCTCTTGCCGCAAAGGACCTCTCCCAAC TTTCCCCTGCGGAGCGCTTGCGGCNACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1694415: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944153123991AA958034TENS1567T. cruzi epimastigote normalized cDNA Library


Date: 2:47:50 on Tue 21 Nov 117.