EST 1694417 is a singleton


Sequence

>1694417 (1 EST) Length=262 TAATCGGCACGAGGCGATGAGGGCTGCACTTCTCTCTCCCTTCCCTACATCCTTTCAGACCACTGCANACTGACNAACTG CAGGGCAGCGGCGTGATTGCAAACCGGGCGTCTATGAGCCAACANACCGTACAATCGACGTGGACCCTTGTCCCCCGTGT CTGGGTGCCGCCACCGTGCTTATTCTTTCTTCCTTCTCGTGTGCTTCGTGTGCGCTTATNATGCCGCTGCTCGCTGTGCA GTGCCGACCCACGTGAGCGAGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1694417: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944173123993AA958036TENS1569T. cruzi epimastigote normalized cDNA Library


Date: 15:13:24 on Thu 23 Nov 117.