EST 1694426 is a singleton


Sequence

>1694426 (1 EST) Length=354 ANTCGGCACGAGGCGACAATTAANAGATCTACTGAGTGTTATTTTGTTTTTTTAATTGATCATGGGCGCTCCCGGCATTG TGTGCCACGCCGATGGCGCCGACTAATAAAANANACAATGGAATGGGGGCACGAAACCACGCCGAGTGTCCCAGTGGAAT ATAAATAATGTGTGGGCACCGGGGGTTTAAACNACTGGAAGGAGTGTAACGTATTTGTTCATTATCTGCAGGCGANACAT GCCCACCGATTTGGATGTCACGCACCAACGTGCAGCTTTTTCTTGTTTCTGAGTGAATGTGTAATGGAANACAGATTTAC CTTTTTTTTTTTTTTTACTTTCCACCCNNNAANA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1694426: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944263124002AA958045TENS1578T. cruzi epimastigote normalized cDNA Library


Date: 19:11:29 on Fri 24 Nov 117.