EST 1694428 is a singleton


Sequence

>1694428 (1 EST) Length=276 AATCGGCACGAGGCCAGCATCTGCNAGGCATTGTTTACCTTTCTCAGCACGTGAACTACTTTTTTCGTGAGGTGCGAGTG CTGGTATTCACNCAGTTTCTGGATTCCTATAGCAGCGTCACGTTGAATTCGATGAGCGCAGCCTTTGGCATTCCCCCACC GGTGCTGGATAGCATGTTGGGAACGCTCATCTCGAATGAGCGTATTGCATGTAAAATGGACCGTGTCTCGGATAGCATCA CTACTTACAGGGGAGATACGACNAACTTTGACTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1694428: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944283124004AA958047TENS1580T. cruzi epimastigote normalized cDNA Library


Date: 23:9:47 on Mon 20 Nov 117.