EST 1694430 is a singleton


Sequence

>1694430 (1 EST) Length=288 TATTCNGCACGAGGCAGGAAAGCTCCGTCTGTACAAGGAAAAACTTGAGGGATATAATCGTTTTTATTCGATTGTTAAAA CGATAAAAATGGTGACCCTTGCCAAATATCGAACTGCTCAAGGCCGAGTCAAAACACGTGACTTTACACTTCGTTATACT GAAAAGGCTTTCAGCAAGCCTCATGCCTCCGANAAAGAAGCTGTAGCTTCCGCGAAAAACGCTCTTGTTTACATTCCGAT TACTACNAATCGAGGCTCTTGTGGAGCTTTGAACAGCAATACGGTTCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1694430: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944303124006AA958049TENS1582T. cruzi epimastigote normalized cDNA Library


Date: 2:2:45 on Sat 18 Nov 117.