EST 1694431 is a singleton


Sequence

>1694431 (1 EST) Length=282 TATTCGGCACGAGGCTTTNTTTTTTTTTTTTTTGTTCCCCGTTAAATGCCGCTCCTGCTCGTCACNATCCTGCCGTGTCA CAAACGACAGTACCGCCTCAATTAGTCAGCGGTGTTGGGGCGAGATGAATGAAAGAACCACACAATGGACAGCTCAAAAA AGAAGAGCGAGAGAGAGAGAGAGAGATAAAAGGAATATACATACATCCATATATATATATTAAGAAGAGAGAAAATGATC AAACACCAGCGAAATAGTCCGAATCAATTACATGTCTCATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1694431: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944313124007AA958050TENS1583T. cruzi epimastigote normalized cDNA Library


Date: 22:31:53 on Thu 18 Jan 118.