EST 1694476 is a singleton


Sequence

>1694476 (1 EST) Length=279 CTCGGAGGCTAGCANTCTTGCACAAGGGTGGCCACNATCCCTCGCATGGAAAAAATTGCCTTTTCTGTGGAGTTATGGCT CTCTGCGCACTGCTGCTCGGGCTCTTTATTCCCGTGCTGAACACCGTCTTTGGGCTGCTGGGCAGTTTCTGTGGCGGCAC TCTCGGCTTCTGCCTGCCGGCGCTATACCGTATGTATTGTGGGAACTGGAGTCTGGGCACCGTGGGAATCGTGAATTATG TTTGCACGTACCTTCTCCTCATGGCTGGTGTGGTTGCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1694476: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944763124052AA958095TENS1628T. cruzi epimastigote normalized cDNA Library


Date: 10:44:5 on Mon 20 Nov 117.