EST 1694487 is a singleton


Sequence

>1694487 (1 EST) Length=258 ATTTCCTCNGAGGTTGCCTCTGCACAAGTTTTTTCTCATNCCCNATTTAAACGGAATTTTCAGTTAGTAATGATTACTCC TACTTAAAAAAAAAAAAAAATTACACCTAAATGTATTTTTGTGTTGTTAAGTGCAAGACATATATGAGAGACCCAAGTGC GTCAAATGGATGTGTTAGCGGTTTTGTTTTCTTCTCACTCCTCCTCTTGACATCCTTTTCTTTCTTTCTCTTTTTTTTTT TTTGCCTCCTCCTCTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1694487: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944873124063AA958106TENS1639T. cruzi epimastigote normalized cDNA Library


Date: 12:16:30 on Mon 20 Nov 117.