EST 1694492 is a singleton


Sequence

>1694492 (1 EST) Length=280 CCATTCGGCACGAGGAGAAACAGAGCGAATAAATACAGCAAAGAGGACGGTGGTGGAATAAAACTCCTTGTAACGCGAGG GAGTCACCACTCAAAGTGAAAGTGAAAGAGAAGGGGAAAGGGAAAGAGGGAAGTCGTCATTGTCGCCGTCGTACTTGTGG TGGCAGCTGCGCCGCACTAAACTCCATCCATCGGCTTGCATCCAGCGCACAAATAAACACATACACGCATACACACTGTC TGCGTTGAAACGGGGGATGACGTCCATCCCTGCTACCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1694492: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16944923124068AA958111TENS1644T. cruzi epimastigote normalized cDNA Library


Date: 13:14:46 on Wed 22 Nov 117.