EST 1694564 is a singleton


Sequence

>1694564 (1 EST) Length=295 ATTTGCCTCNGAGGCGCCCATTCGGCAANAGGATTAAAGAGCCNATNANATAANAGCACTATTTCCGTTTAATATCCATT TTTACAAATGCTTCGTCGTTCTCTTTTACGCATNTCTGGCCTAAACAAANTCCTTGCATTNTCNAAGGCTGTCGGTGACA TCAAATCTGGGGCCTCACTGGCCGTTGGTGGCTTTGGAACGGGANGCATGCCGCATGCACTCTTGGGGGANATTAAAAAA ACCGGCGTGCGGGACCTTTGCATTTACAGTGACGCTNCCGGTACTGATGGTTACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1694564: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16945643124140AA958183TENS1719T. cruzi epimastigote normalized cDNA Library


Date: 11:24:35 on Sun 19 Nov 117.