EST 1694588 is a singleton


Sequence

>1694588 (1 EST) Length=284 CNGCCTCNGAGCCCATTAAAACGGCACNAGGCGTGCCANTGAAATCCCTCAAAAAAATCGGCGGAATGTTTTATGCATTG GCATTGGTCTGTGTTTTTTCTTTCATGAATTTCCTTTGGGATGGATCNANATCTATTTGGTGTGGTACCATGGATGGAGG AGCATCCTCTCGAGTATATCGCTTTTTATCGTCTGGTTGTGTTTTACCATTGGCTTTTTCAGCACCTGGTTGGGTTATAC TTGGTATCTTAGCAAACNACTGCACTTTTACTACACTGCTCGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1694588: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16945883124164AA958207TENS1743T. cruzi epimastigote normalized cDNA Library


Date: 6:13:52 on Thu 23 Nov 117.