EST 1694591 is a singleton


Sequence

>1694591 (1 EST) Length=268 TAAANCGGCACNAGGTTTTTNTTTANAAAANTGTAGCCCCCAGGCTCCGGTGGATGTGGCTACAGTTCCGGGAACCGGGA AGGGGAGCGCATTCCTCATGGAGGGCACGCACCCACAATGAGCTGCCGAGCCCGCAGGANATATGCAAGCAGGAATGACG GTGGGTGGGCGTTCGGTATGCGGTGTGTCTCACGGGAAAAANAAAGCAATGCAAGGGACAAATCAAAATCCCTGCATTTT CCCATAAGCGGAGTCACATTTCGTTGTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1694591: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16945913124167AA958210TENS1747T. cruzi epimastigote normalized cDNA Library


Date: 6:15:51 on Thu 23 Nov 117.