EST 1694596 is a singleton


Sequence

>1694596 (1 EST) Length=184 CTCNGAGGCCACCAATTCGGCACGAGGCTGTACTATATTGGGCGTTTGGAATGGGGCCGAAAAAAGGGTTGAAAAAGACG GAGGANAAGCCTCGCCGTGGAAGGNTCCTCTTTTCGNGGGGTGCACCAGGAATTCNGGCCAATTGGAACGGAANCGGNTA ACCCCACCCGGCCGAAAAATNCAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1694596: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16945963124172AA958215TENS1656T. cruzi epimastigote normalized cDNA Library


Date: 1:12:4 on Mon 20 Nov 117.