EST 1697054 is a singleton


Sequence

>1697054 (1 EST) Length=546 GCAANAGGTTCGTAATGTGCCNCGACTGATGATAACTGCGGTGATAGTGAGCGCAAAGCTTAGGGATGACACCCACTACA GTAACACGTACTATGCGAGCCTTGGTGGCATCAGTACCGCGGAGTTGAACGGGCTGGAACTTGAATTTTTAAANACAATT GATTGGATGACTTGGGTGGAGCCGANTCAGTTTGAGGAATACCGTGCAGGGTTGCAAACGCGATATTTGGAATGCCAGCT TTTCTCCGTGGCGGTTGANAACTCGGAGTATGGCACTANTACCACGGGTGGAGAGCGGGACACCCCACAGTGATGAAGGG TGTTCCCCTCTCTTCTTTTTACTTTTTATTTATTTATTTTTGTTCGTTTTTTACTACATGCGCTTTTTATGTCATGTTAC TGCAACTTTTCATGCATTCGCTCGGGCCCGTGCAGGGGCCTTCAAACGCCGCATCATTTAATGCCCAGAAGANAATATTT CCCTTTGTGTNTTCTGAACGGAACGGATGTGCGTATGTNTTTATGGGAACCTGTTCTTTTAAATCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1697054: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16970543127226AA960728TENS1941T. cruzi epimastigote normalized cDNA Library


Date: 8:38:44 on Fri 24 Nov 117.