EST 1697058 is a singleton


Sequence

>1697058 (1 EST) Length=543 GAGGNCCANATTCGGCACGAGGGAAATAGTGACGGACGCTGTGCCGGATGATGGGAATGATGATAGTGAGGCGGCGAGTA ATGGGAGTGAAGATGGGGAGGATGAAAATGATGGTGATGATGAGGGATGGATTACACCGGAGAACATCCACCAACATCTA CNAGGANCAGCGGATGCGGTGGGGGAGCGGTTTGACGGAGGTGTTGCATGCGTCACCTCCGACTACGCGATGCANAACAC ATTGAAGCATCTGGGCGTCTCCATTGTTGGGCCGCATGGCATGCGCATTCAAAAGCTCCGTCAGTGGCTTCTTCNATGCA CCTCTTGTTTTGCACTCACAACCGACACAACGCGGCAGTTTTGTGGCACATGTGGCAGTGGGAACACACTGAGACGCGTA CAGTATGTTGTGACACGTGAGGGCAAAAAGCACTTTTTATTAACTTTTGCAAGCCCATCAGCACACGTGGCACCGTCTAC AACCTTCCAAAACCACCTTGGGGGAAACCNTNGAACAAACCCCTCCCTGTNCTGCCGGAAGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1697058: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16970583127230AA960732TENS1945T. cruzi epimastigote normalized cDNA Library


Date: 1:9:0 on Mon 20 Nov 117.