EST 1697072 is a singleton


Sequence

>1697072 (1 EST) Length=272 TTANTCGGCACGAGGGCAACGGAGAGAGAAGGGGAAAGGGGTGTTTTCTTCTTGGCATTTTTTTTAATTATTTTANANAT GTCAATTGGTGGGATGCGACGGTTTATCGCTGCTGGTGGTTGTAGCGGTGCGCTCTCGAGTAGTCCTACCGTTTTGGTTT CGGGCGCGAACTCACCTGCAGGTGCCACATTGGCATTAATGATGGCGGCTAGAGGACGTTTTTACAGACCGCTCGTGAAT CAGGGCATTAATCTCTGGCGCTACCGCATGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1697072: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16970723127241AA960743TENS0466T. cruzi epimastigote normalized cDNA Library


Date: 19:24:45 on Wed 22 Nov 117.