EST 1697073 is a singleton


Sequence

>1697073 (1 EST) Length=277 CAATCNTGCACNAGGGATGGCGTCAGCGTCTATGATCAACTCACCCGATTGATGGAGCAGTTGCTGGATGAGAACCCACA TGACATTGCCGCTGACCCATCGAGATTTAACGAAATTTTTACCCTTTTGCAGCAAAGCAGCTTTGTGAATGGACAAAGTA CCCCTGCGTGTAACGAGCCTTGTTCTGTCCCACCGTTTGAACTTGCGCGCCTTGCGGACAATGAACGCCTGTTTGATCGT CCGCCTCCTGAAACATTGACAACAATAGAACAGCCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1697073: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
16970733127242AA960744TENS0677T. cruzi epimastigote normalized cDNA Library


Date: 19:36:22 on Mon 20 Nov 117.