EST 1736845 is a singleton


Sequence

>1736845 (1 EST) Length=281 AAAAAAAGGCACTTTGAACCATTTTTATTGAACTTATAAAGAAAGTAGAAGTACAGAGAAAAGTTAGAAAATCATGGNGC ACAGCCAAATTTTTGACAAACTGGNAAGATTTTCCACCTTNNNGGGTGAACACNCTAGTATGTGTAGCAAACGCGATAAT AGAGGGTTTTCGACCTCCATAAGGNAAAGGAGTTGTNGAATTTAAAAACATATGTTCCCGCACCTGGATACAAATGAGAT CCACAGCACACTTCATTTTGAGAGTTCTGTCGTGAANAGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1736845: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
17368453189765AA999210MCCE0096.M1RSchistosoma mansoni, cercariae


Date: 18:46:41 on Sat 18 Nov 117.